210 code words in two different 3bit codes a minimum distance 1 does not detect al
Báo cáo khoa học: Structure and positioning comparison of two variants of penetratin in two different membrane mimicking systems by NMR pdf
... added and A0 is the amplitude with no paramagnetic agent present N is a normalizing factor in order to normalize the remaining amplitude so that the least affected crosspeak has a remaining amplitude ... by measuring the remaining amplitude The remaining amplitude [40], RA, is defined as: RA ¼ N Á Aparamag: A0 where Aparamag is the amplitude of the crosspeak measured when the paramagnetic agent ... calculated based on 12 9 distance constraints Resonance assignments for all but the two terminal residues were obtained from analysis of TOCSY data and sequential assignments were obtained from...
- 9
- 373
- 0
báo cáo khoa học: " ''''Who''''s who'''' in two different flower types of Calluna vulgaris (Ericaceae): morphological and molecular analyses of flower organ identity" pdf
... http://www.biomedcentral.com /14 71- 2229/9 /14 8 Figure Comparative SEM observations of abaxial and adaxial epidermal surface structures of C vulgaris perianth organs Comparative SEM observations of abaxial and adaxial ... epidermal surface structures of C vulgaris perianth organs wild-type whorl I, abaxial (A) , adaxial (B); wild-type whorl II, abaxial (C), adaxial (D); 'bud-flowering' whorl I, abaxial (E), adaxial ... 18 S rRNA [GenBank:AF 419 797] Forward: GGGATGAGCGGATGTTACTT Reverse: CCCTTCCGTCAATTCCTTTA 11 6 CvAP3 [GenBank:GQ202026] Forward: TCGACGAGCTGAATAGTCTTGA Reverse: TCGACTAGCCCATAGTGTGGAT 19 0 CvSEP1...
- 15
- 233
- 0
Báo cáo y học: "Cardiorespiratory effects of spontaneous breathing in two different models of experimental lung injury: a randomized controlled trial" doc
... Time HCl a a a a a a a a a a a a a a a TMa a Page of 13 (page number not for citation purposes) Critical Care Vol 12 No Varelmann et al Table (Continued) Oxygenation and hemodynamic parameters - ... supplementary/cc 710 8-S1.doc 11 12 13 14 Acknowledgements We thank Eva-Maria Hedin, Anne Abrahamson, and Agneta Roneus, all technicians at the Department of Clinical Physiology, and the x-ray laboratory ... atelectasis formation and resulting in improvement in V A Q matching [14 ,16 ] The finding that EELV was lower in OA-induced ALI can be explained by the elevated IAP and, as a consequence, a cranial...
- 13
- 305
- 0
“How ethics and gender affect mixed genders of students in accounting universities?” (Comparing two different accounting faculties in two different universities in Ha Noi)
... Russia, China, Bulgaria, Poland, and Slovakia, Czech Republic, England, France, America, Australia, Japan, Sweden, Holland, Germany, Canada, Korea, Thailand particular period, schools also receive ... Descriptive data analysis concluding the mean, median and standard deviation, variance ( ; ; )for ethical reasoning (DIT2 mark), moral behavior (Mach IV score), and ethical ratings (E .A and E.B) can be ... Ponemon and Gabhart, 19 93; Trevino, 19 86; Trevino and Youngblood, 19 90) also indicate that the ethical individual that are not willing join in unethical behaviors Other studies (Ponemon, 19 94; Windsor...
- 94
- 299
- 0
The chart below shows the sleep patterns of people in five different occupations according to a Canadian study
... wake at a. m., but nap for two hours or so in the early afternoon Thus the influence on one's sleep pattern is worthy of consideration when choosing an occupation ...
- 2
- 1,418
- 3
Báo cáo khoa hoc:" Genetic variation in two conserved local Romanian pig breeds using type 1 DNA markers" pdf
... rare livestock in Romania although it will be a difficult task as the remaining populations are relatively small In pigs there are two rare breeds: the Red Mangalitsa and Bazna The Mangalitsa ... between the Bazna and Mangalitsa populations, according to the marker data (Tab II) RESULTS 3 .1 DNA markers associated with meat quality 3 .1. 1 Calcium Release Channel (CRC1) The halothane or stress ... Production, Armidale, Australia, January 11 16 , 19 98 [42] Yeo G.S., Farooqi I.S., Aminian S., Halsall D.J., Stanhope R.G., O’Rahilly S., A frameshift mutation in MC4R associated with dominantly inherited...
- 16
- 282
- 0
Báo cáo y học: "Intussusception of the small bowel secondary to malignant metastases in two 80-year-old people: a case series" potx
... up and drug administration (letrozole and zoledronic acid) Second case An 80-year-old Caucasian man was admitted to an internal medicine department at our hospital complaining of acute abdominal ... 8:324-326 10 Branum GD, Seigler HF: Role of Surgical Intervention in the Management of Intestinal Metastases From Malignant Melanoma Am J Surg 19 91, 62:428-4 31 11 Yokota T, Kunii Y, Kagami M, Takahashi ... difficult and in almost 50% of the cases it is established intra-operatively [6] In a simple abdominal radiograph the findings are not disease-specific, and in the radiological examination with barium...
- 4
- 275
- 0
Vietnamese – English code-switching in conversations among Vietnamese EFL teachers a case study
... because the language changes.” Conversely, he views code- mixing as a case “where a fluent bilingual talking to another fluent bilingual changes language without any change at all in the situation.”, ... code- switching 0.93% Inter-sentential 0% Intra-sentential 211 99.07% Total 213 10 0% Table Breakdown of detected code- switching instances according to Poplack‟s (19 80) typology Table shows that intra-sentential ... It was also found out in this chapter that different syntactic word classes switch at different rates As regards reasons for code- switching, the data analysis process has also revealed that habitual...
- 17
- 879
- 15
báo cáo khoa học:" Effect of neck strength training on health-related quality of life in females with chronic neck pain: a randomized controlled 1-year follow-up study" docx
... data collection and participated in drafting of the manuscript All authors read and approved the final manuscript Author Details 1Department of Physical and Rehabilitation Medicine, Central Finland ... mechanical neck pain Arch Phys Med Rehabil 19 91, 72(9):679-6 81 21 Ylinen JJ, Savolainen S, Airaksinen O, Kautiainen H, Salo P, Hakkinen A: Decreased strength and mobility in patients after anterior ... P, Cassidy JD, Carroll L: The factors associated with neck pain and its related disability in the Saskatchewan population Spine 2000, 25(9) :11 09 -11 17 Aromaa A, Koskinen S: Health and functional...
- 7
- 367
- 0
Báo cáo y học: " Intragenic transcriptional cis-activation of the human immunodeficiency virus 1 does not result in allele-specific inhibition of the endogenous gene" pdf
... AxGTCGACCTGCAGACAxGGGTGATCCTCAxGTTTTCTAGGCAATxA AxAGTTTCCAGAAxTCCACACCGGAGACCCCACxTCCAGGATTCAAACCxT CxCAGCGTCCGCxCACTTCCTCCCCAAAACCCCxCCAAAAAAATTGTTxT AxGGTTGGTATAAACACAxAAAGCATGGTGGTxGTCTGGAGCTGGGGTTxA AxTGCAGTGAGCCATGAxCACACCACAGTACxACAGCCTGGGTGATGAAxA ... AxTGCAGTGAGCCATGAxCACACCACAGTACxACAGCCTGGGTGATGAAxA AxATTGCTGTCCTAAxCAGACTGCACCTGTGGxGTGGCTCTGACTGGTxA AxGGTATGGTGGCAAAxCGACTCCCCCAGxACAACCACCAGAATATCAGxA AxACGCCGAAGTCGCxGAAGCAGATCTATCTGCxCTATGGTAAATCTGGxA AxATAACTGTTGCTAGGxGACGGGGACATTCCCGAAxGCTGCGTCTGTxA ... GGAATGGAACAGTGAAGAAGCA AATGGTAGATAACGCAGATCATC ACCACTGGAAAGGAACTAAGCA PROBES FOR RNA FISH HIV_MS2 HMBOX_E 1a HMBOX_E1b HMBOX_I 2a HMBOX_I2b HMBOX_I2c HMBOX_I2d HMBOX_E 4a HMBOX_E4b AxGTCGACCTGCAGACAxGGGTGATCCTCAxGTTTTCTAGGCAATxA...
- 15
- 329
- 0
bài 10. lắp đặt mạch điện 1ct 3 cực đk 2 đèn
... Kiểm tra cũ 1. Vẽ sơ đồ lắp đặt mạch điện cầu thang sử dụng hai công tắc cực điều khiển đèn? Sơ đồ mạch điện sau sai? A a) A b) Sơ đồ lắp đặt MĐ công tắc cực điều khiển đèn A Tác động vào ... kìm tuốt dây, dao nhỏ, tua vit, Xây dựng sơ đồ lắp đặt mạch điện khoan điện (khoan tay) a Tìm hiểu sơ đồ nguyên lý mạch điện - Vật liệu thiết bị: dây dẫn điện, đui đèn, công tắc 3A cực, công tắc ... điện Nguyên lý làm việc mạch điện A 1 K Khi tắc công tắc Khi bật công bật sang vị trísang vị trí Đ2 Bài 10 Thực hành Lắp mạch điện công tắc cực điều khiển hai đèn I Dụng cụ, vật liệu thiết bị...
- 16
- 3,601
- 11
Gián án Đề khảo sát HSG toán 3- lần 2(10-11)
... sinh anh năm mẹ tuổi ? Cõu 5: Có hộp bút chì Nếu lấy bút chì từ hộp thứ chuyển sang hộp thứ hai, lại lấy bút chì từ hộp thứ hai chuyển sang hộp thứ ba, cuối lấy bút chì hộp thứ ba chuyển sang ... ta dự kiến bố trí chỗ ngồi đủ cho 12 8 ngời dự Nhng thực tế có 16 0 ngời dự, nên dãy ghế phải thêm chỗ ngồi Hỏi có tất dãy ghế ? Cõu 4: Năm nay, mẹ 38 tuổi Sang năm, tuổi anh tuổi mẹ Hỏi mẹ sinh ... từ hộp thứ hai chuyển sang hộp thứ ba, cuối lấy bút chì hộp thứ ba chuyển sang hộp thứ mi hộp có 12 bút chì Hỏi thực hộp có bút chì ? ...
- 3
- 420
- 0
Tài liệu Đề khảo sát HSG toán 3- lần 2(10-11)
... sinh anh năm mẹ tuổi ? Cõu 5: Có hộp bút chì Nếu lấy bút chì từ hộp thứ chuyển sang hộp thứ hai, lại lấy bút chì từ hộp thứ hai chuyển sang hộp thứ ba, cuối lấy bút chì hộp thứ ba chuyển sang ... ta dự kiến bố trí chỗ ngồi đủ cho 12 8 ngời dự Nhng thực tế có 16 0 ngời dự, nên dãy ghế phải thêm chỗ ngồi Hỏi có tất dãy ghế ? Cõu 4: Năm nay, mẹ 38 tuổi Sang năm, tuổi anh tuổi mẹ Hỏi mẹ sinh ... từ hộp thứ hai chuyển sang hộp thứ ba, cuối lấy bút chì hộp thứ ba chuyển sang hộp thứ mi hộp có 12 bút chì Hỏi thực hộp có bút chì ? ...
- 3
- 321
- 0
Bài soạn Đề khảo sát HSG toán 3- lần 2(10-11)
... sinh anh năm mẹ tuổi ? Cõu 5: Có hộp bút chì Nếu lấy bút chì từ hộp thứ chuyển sang hộp thứ hai, lại lấy bút chì từ hộp thứ hai chuyển sang hộp thứ ba, cuối lấy bút chì hộp thứ ba chuyển sang ... ta dự kiến bố trí chỗ ngồi đủ cho 12 8 ngời dự Nhng thực tế có 16 0 ngời dự, nên dãy ghế phải thêm chỗ ngồi Hỏi có tất dãy ghế ? Cõu 4: Năm nay, mẹ 38 tuổi Sang năm, tuổi anh tuổi mẹ Hỏi mẹ sinh ... từ hộp thứ hai chuyển sang hộp thứ ba, cuối lấy bút chì hộp thứ ba chuyển sang hộp thứ mi hộp có 12 bút chì Hỏi thực hộp có bút chì ? ...
- 3
- 350
- 0
Tài liệu Pro .NET 2.0 Code and Design Standards in C# docx
... Identifiers—Pascal Notation Identifier Notation Example Class Pascal Car Constant Pascal MaximumValue Delegate Pascal ChangeInformation Enum Type Pascal ColorChoice Enum Value Pascal OnlyBlack Event (Delegate) ... DataGrid dg dgName 9A ASP.NET DataGridColumn dgc dgcName 1 0A ASP.NET DataGridItem dgi dgiName 1 1A ASP.NET DataList dl dlName 1 2A ASP.NET DropDownList ddl ddlName 1 3A ASP.NET HyperLink hl hlName ... chapters Chapter 10 : Creational Patterns Creational patterns are about strategically manipulating the instantiation of classes In this chapter and all the subsequent pattern chapters, the code...
- 361
- 925
- 0
Pro .NET 2.0 Code and Design Standards in C# ppt
... Identifiers—Pascal Notation Identifier Notation Example Class Pascal Car Constant Pascal MaximumValue Delegate Pascal ChangeInformation Enum Type Pascal ColorChoice Enum Value Pascal OnlyBlack Event (Delegate) ... DataGrid dg dgName 9A ASP.NET DataGridColumn dgc dgcName 1 0A ASP.NET DataGridItem dgi dgiName 1 1A ASP.NET DataList dl dlName 1 2A ASP.NET DropDownList ddl ddlName 1 3A ASP.NET HyperLink hl hlName ... chapters Chapter 10 : Creational Patterns Creational patterns are about strategically manipulating the instantiation of classes In this chapter and all the subsequent pattern chapters, the code...
- 361
- 629
- 1
Báo cáo khoa học: Evidence for two different electron transfer pathways in the same enzyme, nitrate reductase A from Escherichia coli potx
... pJF 119 EH(narGHIJ)Apr, as overexpressed wildtype plasmid [17 ] and pVA700-C16, pJF 119 EH(narGH[C1 6A] IJ)Apr, as plasmid lacking the high-potential [4Fe-4S] cluster [17 ] These were obtained with a ... corresponding to apparent rate constants are obtained by fitting Eqn (1) : DAbs ¼ a þ b eÀct 1 where, DAbs is the variation of absorbance, a and b are amplitude parameters and c is the time constant ... corresponding to the sum of three exponentials at least These traces are too complex to be analysed with precision The residual plots, difference between experimental data and calculated values obtained...
- 8
- 442
- 0
Báo cáo khoa học: Unchanged thymidine triphosphate pools and thymidine metabolism in two lines of thymidine kinase 2-mutated fibroblasts docx
... mitochondrial diseases of DNA replication Annu Rev Med 59, 13 1 14 6 11 12 Saada A, Shaag A, Mandel H, Nevo Y, Eriksson S & Elpeleg O (20 01) Mutant mitochondrial thymidine kinase in mitochondrial DNA depletion ... myopathy Nat Genet 29, 342–344 Mandel H, Szargel R, Labay V, Elpeleg O, Saada A, Shalata A, Anbinder Y, Berkowitz D, Hartman C, Barak M et al (20 01) The deoxyguanosine kinase gene is mutated in individuals ... Molecular insights into mitochondrial DNA depletion syndrome in two patients with FEBS Journal 276 (2009) 11 04 11 13 ª 2009 The Authors Journal compilation ª 2009 FEBS M Frangini et al 14 15 16 17 18 ...
- 10
- 309
- 0
báo cáo hóa học: " Validation of two complementary oral-health related quality of life indicators (OIDP and OSS 0-10 ) in two qualitatively distinct samples of the Spanish population" potx
... percentage of impacts attributable to a given causal entity in a given dimension Oral satisfaction assessment The Oral Satisfaction Scale (OSS) is a visual analogue scale (0 to 10 ) that allows subjects ... finding that all correlations were > 0.20 (Table 1) The standardised Cronbach's alpha value obtained from the correlation matrix was 0.79, and this alpha value was not increased by the removal ... = 5 61) DIMENSION CAUSE Eating Speaking Cleaning Working Social Sleeping & Relaxing Smiling Emotional state Value Oral ulcers Dental pain Third-molar pain Prosthesis TMJ paindysfunction Missing...
- 14
- 489
- 0
báo cáo hóa học:" Proximal screws placement in intertrochanteric fractures treated with external fixation: comparison of two different techniques" pdf
... Postoperative Management Evaluation during treatment included plain radiographs and pain assessment using the visual analog scale (VAS) Clinical evaluation of patients was assessed with the Harris Hip ... with a walker or crutches was encouraged The patients were advised to partial weight-bearing depending on tolerance to pain Weight-bearing was gradually increased and full weight-bearing was allowed ... According to the American Society of Anesthesiologists, 47 patients were scored as ASA and 23 patients as ASA In group A, 12 patients had an AO type A1 fracture and 23 patients had an AO type A2 ...
- 7
- 234
- 0
Tìm thêm: xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25